This paper presents results of an investigation and listing of tick species found in China during a survey in all 28 provinces. This will be a step towards a definitive list of tick species and their distribution. To date, the tick fauna of this area consists of 117 species in the following families: Argasidae-Argas (7 species), Carios (4 species) and Ornithodoros (2 species); Ixodidae-Amblyomma (8 species), Anomalohimalaya (2 species), Dermacentor (12 species), Haemaphysalis (44 species), Hyalomma (6 species), Ixodes (24 species) and Rhipicephalus (8 species). Some well known ticks carrying and transmitting many infectious agents to man and domestic animals are also found in China. These include Ixodes persulcatus, Haemaphysalis longicornis, Rhipicephalus sanguineus, R. (Boophilus) microplus and Hyalomma asiaticum. It is worth mentioning that Ixodes rangtangensis Teng and Haemaphysalis xinjiangensis Teng should be relegated to a synonym of I. moschiferi and Hae. danieli, respectively. The distribution of ticks over the provinces of China is also discussed. The information on ticks in some areas such as Henan is not exhaustive.

In this study, we reported two featured series of rRNA-derived RNA fragments (rRFs) from the small RNA sequencing (sRNA-seq) data of Amblyomma testudinarium using the Illunima platform. Two series of rRFs (rRF5 and rRF3) were precisely aligned to the 5' and 3' ends of the 5.8S and 28S rRNA gene. The rRF5 and rRF3 series were significantly more highly expressed than the rRFs located in the body of the rRNA genes. These series contained perfectly aligned reads, the lengths of which varied progressively with 1-bp differences. The rRF5 and rRF3 series in the same expression pattern exist ubiquitously from ticks to human. The cellular experiments showed the RNAi knockdown of one 20-nt rRF3 induced the cell apoptosis and inhibited the cell proliferation. In addition, the RNAi knockdown resulted in a significant decrease of H1299 cells in the G2 phase of the cell cycle. These results indicated the rRF5 and rRF3 series were not random intermediates or products during rRNA degradation, but could constitute a new class of small RNAs that deserves further investigation.

No abstract

In this study, we used pan RNA-seq analysis to reveal the ubiquitous existence of both 5′ and 3′ end small RNAs (5′ and 3′ sRNAs). 5′ and 3′ sRNAs alone can be used to annotate nuclear non-coding and mitochondrial genes at 1-bp resolution and identify new steady RNAs, which are usually transcribed from functional genes. Then, we provided a simple and cost effective way for the annotation of nuclear non-coding and mitochondrial genes and the identification of new steady RNAs, particularly long non-coding RNAs (lncRNAs). Using 5′ and 3′ sRNAs, the annotation of human mitochondrial was corrected and a novel ncRNA named non-coding mitochondrial RNA 1 (ncMT1) was reported for the first time in this study. We also found that most of human tRNA genes have downstream lncRNA genes as lncTRS-TGA1-1 and corrected the misunderstanding of them in previous studies. Using 5′, 3′, and intronic sRNAs, we reported for the first time that enzymatic double-stranded RNA (dsRNA) cleavage and RNA interference (RNAi) might be involved in the RNA degradation and gene expression regulation of U1 snRNA in human. We provided a different perspective on the regulation of gene expression in U1 snRNA. We also provided a novel view on cancer and virus-induced diseases, leading to find diagnostics or therapy targets from the ribonuclease III (RNase III) family and its related pathways. Our findings pave the way toward a rediscovery of dsRNA cleavage and RNAi, challenging classical theories.

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.

No abstract

No abstract

No abstract