Thrips palmi (Thysanoptera: Thripidae) is an important pest of vegetables, ornamentals, and legumes worldwide. Besides damage caused by feeding, it transmits several tospoviruses. Identification of T. palmi at an early stage is crucial in implementing appropriate pest management strategies. Morpho-taxonomic identification of T. palmi based on the adult stage is time-consuming and needs taxonomic expertise. Here, we report a rapid, on-site, field-based assay for identification of T. palmi based on recombinase polymerase amplification (RPA), its first application in insects. RPA primers designed based on 3′ polymorphisms of the Internal Transcribed Spacer 2 region efficiently discriminated T. palmi without any cross-reactivity to other predominant thrips species. RPA was performed with crude DNA, extracted from single T. palmi simply by crushing in sterile distilled water and could be completed within 20 min by holding the reaction tubes in the hand. The assay was further simplified by using fluorescent as well as colorimetric dyes thus eliminating the gel-electrophoresis steps. The presence of T. palmi was visualized by a change in color from dark blue to sky blue. The assay was validated with known thrips specimens and found to be effective in diagnosing the presence of T. palmi in natural vegetation. This on-site, rapid assay for diagnosis of T. palmi can be used by non-expert personnel in the field of quarantine and pest management. Keywords RPA • Melon thrips • Insect vector • Tospovirus transmission • Thrips diagnostics Key message • Thrips palmi an important pest of vegetables and ornamentals transmitting several tospoviruses • Morpho-taxonomic identification stage-specific, timeconsuming, and needs taxonomic expertise • Rapid, on-site, field-based assay for identification of T. palmi using recombinase polymerase amplification • Assay uses crude extract of T. palmi, completed within 20 min by holding the reaction tubes in hand without use of sophisticated laboratory instruments • The presence of T. palmi visualized by a change in reaction color • Useful for non-expert personnel in field-based identification, quarantine, and adopting suitable pest management strategies
Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.
Columnea latent viroid, originating from ornamental plants, is known to be harmful to crop plants (2). Despite the potential threat to crop plants, the importance of ornamental plants in viroid evolution is not fully appreciated. Availability of a Pospiviroid genus-specific primer pair (1) to detect the most prevalent viroids in ornamental plants and a simplified nucleic acid preparation protocol (3) for use in reverse-transcription polymerase chain reaction (RT-PCR) have facilitated surveys of ornamental plants for pospiviroids. Using the above protocol in India, leaf and shoot samples were collected randomly from roadside beds consisting of ground covers or creepers/trailing plants at the IARI campus, New Delhi. These were extracted in 50 mM NaOH + 2.5 mM EDTA solution, centrifuged to sediment the coarse debris from sap, and 10 μl of the supernatant was spotted on a nitrocellulose membrane. Individual spots were eluted with distilled sterile water (30 μl) and the eluates were used for RT-PCR detection of viroids (3). Amplified fragments or subsequently cloned plasmids were also purified using NaOH-EDTA membrane protocol. Cloning and sequencing of amplicons (195 to 224 bp) revealed a very high sequence identity with specific viroids from the viroid sequence database (NCBI). Among the 19 plant samples assayed, only three plant species were infected by viroids, although none of them exhibited any symptoms. The three plant species included: (i) moss verbena, Glandularia puchella (Verbenaceae, native to Argentina and Chile, now established in several regions of the world), infected with a viroid (Accession No. DQ846884) having 99% sequence identity to Citrus exocortis viroid (CEVd) (Accession No. S67446); (ii) trailing verbena, Verbena × hybrida (Verbenaceae, ornamental plant), doubly infected with a viroid (Accession No. DQ846885) having 95% sequence identity to CEVd (Accession No. DQ094297) and infected with another viroid (Accession No. DQ846883) having 98% sequence identity to Tomato chlorotic dwarf viroid (TCDVd) (Accession No. AF162131); and (iii) red joyweed, Alternanthera sessilis (Amaranthaceae, a perennial weed herb) infected with a viroid (Accession No. DQ846886) having 96% sequence identity to Iresine viroid (IrVd) (Accession No. DQ094293). CEVd and TCDVd were mechanically transferred to tomato seedlings causing reduced growth of plants, smaller leaves, and bunchy-top appearance of plants, symptoms similar to those typically observed with other isolates of these viroids. As expected from previous studies, IrVd was not transmitted to tomato plants. Natural infection of verbena with CEVd has been detected in North America (2) but this was a novel observation in India. Additional novel observations include: A. sessilis as a new host for IrVd; and TCDVd is the first crop viroid to be isolated from a naturally infected ornamental plant. The significance of these viroid findings in ground cover and widely grown ornamental plants may lie in their potential role in spreading the viroids to citrus plants in citrus-growing countries such as India. References: (1) H. Bostan et al. J. Virol. Methods 116:189, 2004, (2) R. P. Singh and J. A. Teixeira da Silva. Floriculture, Ornamental Plant Biotechnol. 3:531, 2006. (3) R. P. Singh et al. J. Virol. Methods 132:204, 2006.
Two distinct types of symptoms, severe yellow mosaic and chlorotic vein-banding, were observed on Bougainvillea spectabilis at two different locations in India. Electron microscopy revealed bacilliform virus particles in leaf samples from both places. PCR amplification, cloning, sequencing and sequence analysis of reverse transcriptase and ribonuclease H coding region in open reading frame 3 indicated that two distinct badnaviruses are associated with B. spectabilis in India.Keywords Badnavirus Á Bougainvillea spectabilis Á Delhi Á Tirupati Á PCR Bougainvillea spectabilis Willd (flower paper) is a widely grown ornamental plant in India. During 2008, B. spectabilis plants developed distinct severe yellow mosaic (SYM) in parts of Tirupati (Fig. 1a). Subsequently in 2009, a chlorotic vein-banding (CVB) was noticed on leaves of B. spectabilis on the campus of the Indian Agricultural Research Institute, New Delhi (Fig. 1b). Leaf dip electron microscopy of symptomatic bougainvillea leaves revealed the association of bacilliform virus particles measuring 120-150 nm 9 20 nm (Fig. 2). Previously, bacilliform virus particles have been shown to be associated with bougainvillea plants with CVB in Brazil (Rivas et al. 2005) and mottling, chlorosis, vein-banding and stunting in Taiwan (Tsai et al. 2005).To confirm the virus identity, symptomatic leaves of bougainvillea collected from Tirupati and Delhi were subjected to polymerase chain reaction (PCR) amplification using two degenerate Badnavirus primers viz. BadnaFP (5 0 ATGCCITTYGGIAARAAYGCICC3 0 ) and BadnaRP (5 0 CCAYTTRCAIACISCICCCCAICC3 0 ) corresponding to putative ribonuclease H (RNase H) and reverse transcriptase (RT) coding regions (Yang et al. 2003). Both samples yielded an amplicon of approximately 600 bp, and no amplification was observed in healthy, symptomless bougainvillea (Fig. 3). The amplicons were cloned in pGEM-T easy vector (Promega, Madison, WI, USA) and sequenced. BLAST analysis of the 577 bp of RNase H and RT nucleotide sequences of viral DNA from bougainvillea with SYM symptoms from Tirupati (accession GQ254410) had maximum sequence identity of 73% in open reading frame 3 (ORF 3) of Bougainvillea spectabilis chlorotic vein-banding virus (BsCVBV) (accessions EU034539, DQ347841, and DQ103759). An identical sequence size of amplified viral DNA isolated from bougainvillea with CVB symptoms from Delhi (accession GQ254411) had 72% sequence identity with the sequences of same three BsCVBV isolates. Nucleotide and amino acid sequences of putative RT and RNase H region of ORF 3 of these two badnaviruses were analyzed using Bio Edit version 7.0.4 for sequence identities with other badnaviruses. The two badnaviruses infecting bougainvillea in India shared an identity of 76.2% in nucleotide and 88.6% in amino acid sequences with each other. Comparison of nucleotide and amino acid sequences of badnaviruses infecting bougainvillea from India and Taiwan showed identities in the range of 72.3-73.5% for nucleotides and 83.4-84.9% in amino acids of RT and RNase H. Be...
scite is a Brooklyn-based organization that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students and researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
10624 S. Eastern Ave., Ste. A-614
Henderson, NV 89052, USA
Copyright © 2024 scite LLC. All rights reserved.
Made with 💙 for researchers
Part of the Research Solutions Family.