Interactions of cytochrome c (cyt c) with cardiolipin (CL) are important for both electron transfer and apoptotic functions of this protein. A sluggish peroxidase in its native state, when bound to CL, cyt c catalyzes CL peroxidation, which contributes to the protein apoptotic release. The heterogeneous CL-bound cyt c ensemble is difficult to characterize with traditional structural methods and ensemble-averaged probes. We have employed time-resolved FRET measurements to evaluate structural properties of the CL-bound protein in four dansyl (Dns)-labeled variants of horse heart cyt c. The Dns decay curves and extracted Dns-to-heme distance distributions PðrÞ reveal a conformational diversity of the CL-bound cyt c ensemble with distinct populations of the polypeptide structures that vary in their degree of protein unfolding. A fraction of the ensemble is substantially unfolded, with Dns-to-heme distances resembling those in the guanidine hydrochloride-denatured state. These largely open cyt c structures likely dominate the peroxidase activity of the CL-bound cyt c ensemble. Site variations in PðrÞ distributions uncover structural features of the CL-bound cyt c, rationalize previous findings, and implicate the prime role of electrostatic interactions, particularly with the protein C terminus, in the CL-induced unfolding.membrane | redox protein | fluorescence
Antigen uptake and processing by innate immune cells is crucial to initiate the immune response. Therein, the endocytic C-type lectin receptors serve as pattern recognition receptors, detecting pathogens by their glycan structures. Herein, we studied the carbohydrate recognition domain of Langerin, a C-type lectin receptor involved in the host defense against viruses such as HIV and influenza as well as bacteria and fungi. Using a combination of nuclear magnetic resonance and molecular dynamics simulations, we unraveled the molecular determinants underlying cargo capture and release encoded in the receptor architecture. Our findings revealed receptor dynamics over several time scales associated with binding and release of the essential cofactor Ca(2+) controlled by the coupled motions of two loops. Applying mutual information theory and site-directed mutagenesis, we identified an allosteric intradomain network that modulates the Ca(2+) affinity depending on the pH, thereby promoting fast ligand release.
Mammalian C-type lectin receptors (CTLRS) are involved in many aspects of immune cell regulation such as pathogen recognition, clearance of apoptotic bodies, and lymphocyte homing. Despite a great interest in modulating CTLR recognition of carbohydrates, the number of specific molecular probes is limited. To this end, we predicted the druggability of a panel of 22 CTLRs using DoGSiteScorer. The computed druggability scores of most structures were low, characterizing this family as either challenging or even undruggable. To further explore these findings, we employed a fluorine-based nuclear magnetic resonance screening of fragment mixtures against DC-SIGN, a receptor of pharmacological interest. To our surprise, we found many fragment hits associated with the carbohydrate recognition site (hit rate = 13.5%). A surface plasmon resonance-based follow-up assay confirmed 18 of these fragments (47%) and equilibrium dissociation constants were determined. Encouraged by these findings we expanded our experimental druggability prediction to Langerin and MCL and found medium to high hit rates as well, being 15.7 and 10.0%, respectively. Our results highlight limitations of current in silico approaches to druggability assessment, in particular, with regard to carbohydrate-binding proteins. In sum, our data indicate that small molecule ligands for a larger panel of CTLRs can be developed.
Staphylococcus aureus is a major cause of skin and soft tissue infections and aggravator of the inflammatory skin disease atopic dermatitis (AD [eczema]). Epicutaneous exposure to S. aureus induces Th17 responses through skin Langerhans cells (LCs), which paradoxically contribute to host defense but also to AD pathogenesis. The molecular mechanisms underlying the interaction between S. aureus and LCs are poorly understood. Here we demonstrate that human LCs directly interact with S. aureus through the pattern recognition receptor langerin (CD207). Human, but not mouse, langerin interacts with S. aureus through the conserved β-N-acetylglucosamine (GlcNAc) modifications on wall teichoic acid (WTA), thereby discriminating S. aureus from other staphylococcal species. Importantly, the specific S. aureus WTA glycoprofile strongly influences the level of proinflammatory cytokines that are produced by in vitro-generated LCs. Finally, in a murine epicutaneous infection model, S. aureus strongly upregulated transcripts of Cxcl1, Il6, and Il17, which required the presence of both human langerin and WTA β-GlcNAc. Our findings provide molecular insight into the unique proinflammatory capacities of S. aureus in relation to skin inflammation. IMPORTANCE The bacterium Staphylococcus aureus is an important cause of skin infections and is also associated with the occurrence and severity of eczema. Langerhans cells (LCs), a specific subset of skin immune cells, participate in the immune response to S. aureus, but it is yet unclear how LCs recognize S. aureus. Therefore, we investigated the molecular mechanism underlying the interaction between LCs and S. aureus. We identified that wall teichoic acid, an abundant polymer on the S. aureus surface, is recognized by langerin, a receptor unique to LCs. This interaction allows LCs to discriminate S. aureus from other related staphylococcal species and initiates a proinflammatory response similar to that observed in patients with eczema. Our data therefore provide important new insights into the relationship between S. aureus, LCs, and eczema.
DC-SIGN is a cell-surface receptor for several pathogenic threats, such as HIV, Ebola virus, or Mycobacterium tuberculosis. Multiple attempts to develop inhibitors of the underlying carbohydrate-protein interactions have been undertaken in the past fifteen years. Still, drug-like DC-SIGN ligands are sparse, which is most likely due to its hydrophilic, solvent-exposed carbohydrate-binding site. Herein, we report on a parallel fragment screening against DC-SIGN applying SPR and a reporter displacement assay, which complements previous screenings using F NMR spectroscopy and chemical fragment microarrays. Hit validation by SPR and H- N HSQC NMR spectroscopy revealed that although no fragment bound in the primary carbohydrate site, five secondary sites are available to harbor drug-like molecules. Building on key interactions of the reported fragment hits, these pockets will be targeted in future approaches to accelerate the development of DC-SIGN inhibitors.
Cardiolipin (CL) is a unique phospholipid found in mitochondrial inner membrane. It is a key component for mitochondrial function in both respiration and apoptosis. The level of CL is an important parameter for investigating these intracellular events and is a critical indicator of a number of diseases associated with mitochondrial respiratory functions. 10-Nonyl acridine orange (NAO) is the only fluorescent dye currently available for CL detection. However, the performance of NAO is far from satisfactory in terms of selectivity and sensitivity. In this work, we report an aggregation-induced emission-active fluorogen, TTAPE-Me, for CL detection and quantification. With improved sensitivity and excellent selectivity to CL over other major mitochondrial membrane lipids, TTAPE-Me could serve as a valuable fluorescent sensor for CL quantification. The use of TTAPE-Me for the quantification of isolated mitochondria is also demonstrated.
Synthetic cell-surface glycans are promising vaccine candidates against Clostridium difficile. The complexity of large, highly antigenic and immunogenic glycans is a synthetic challenge. Less complex antigens providing similar immune responses are desirable for vaccine development. Based on molecular-level glycan–antibody interaction analyses, we here demonstrate that the C. difficile surface polysaccharide-I (PS-I) can be resembled by multivalent display of minimal disaccharide epitopes on a synthetic scaffold that does not participate in binding. We show that antibody avidity as a measure of antigenicity increases by about five orders of magnitude when disaccharides are compared with constructs containing five disaccharides. The synthetic, pentavalent vaccine candidate containing a peptide T-cell epitope elicits weak but highly specific antibody responses to larger PS-I glycans in mice. This study highlights the potential of multivalently displaying small oligosaccharides to achieve antigenicity characteristic of larger glycans. The approach may result in more cost-efficient carbohydrate vaccines with reduced synthetic effort.
Receptor Expression and Purification General remarks Codon-optimized genes for the expression of Langerin in E. coli were purchased from GenScript. All growth media or chemicals used for receptor expression and purification were purchased from Carl Roth if not stated otherwise. Langerin ECD The truncated Langerin ECD (residues 148 to 328, forward primer: GGTGGTCATATGGCCTCGAC GCTGAATGCCCAGATTCCGG, reverse primer: ACCACCAAGCTTTTATTTTTCAAACTGCGG ATG) was cloned with a C-terminal TEV cleavage site and a Strep-tag II into a pET30a expression vector (EMD Millipore) and expressed insolubly in E. coli BL21 * (DE3) (Invitrogen). Precultures were incubated overnight in LB medium supplemented with 35 µg•ml-1 Kanamycin (50 ml) at 37° C and 220 rpm. The preculture was diluted to an OD 600 of 0.1 into LB medium supplemented with 35 mg•ml-1 Kanamycin (500 ml). The culture was incubated at 37° C and 220 rpm and expression of the Langerin ECD was induced with 0.5 mM IPTG at an OD 600 of 0.6 to 0.8. Cells were harvested 4 h after induction via centrifugation at 4000 g and 4° C for 20 min. Cell pellets were stored overnight at-20° C and subsequently resuspended in 50 mM Tris with 0.1% Triton X-100 and 10 mM MgCl 2 (20 ml) at pH 7.5. Lysozyme (Sigma Aldrich) was added and the sample was incubated for 3.5 h at 4° C. After the addition of DNase I (AppliChem) the sample was incubated for another 30 min at 4° C.
scite is a Brooklyn-based startup that helps researchers better discover and understand research articles through Smart Citations–citations that display the context of the citation and describe whether the article provides supporting or contrasting evidence. scite is used by students researchers from around the world and is funded in part by the National Science Foundation and the National Institute on Drug Abuse of the National Institutes of Health.
hi@scite.ai
334 Leonard St
Brooklyn, NY 11211
Copyright © 2023 scite Inc. All rights reserved.
Made with 💙 for researchers