Browning of the pADR depot occurred in half of pheo patients and was associated with increased catecholamines and mitochondrial activity. No browning was detected in other fat depots, suggesting that other factors are required to promote browning in these depots.

Cowpea Chlorotic Mottle Virus is a single-stranded RNA plant virus with a diameter of 28 nm. The proteins comprising the capsid of this virus can be purified and reassembled either by themselves to form hollow structures, or with polyanions like double-stranded DNA or single-stranded RNA. Depending on pH and ionic strength, a diverse range of structures and shapes can form. The work presented here focuses on using these proteins to encapsulate a fluorescent polyanionic semiconducting polymer, MPS-PPV (poly-2-methoxy-5-propyloxy sulfonate phenylene vinlyene), in order to obtain optically active virus-like particles. After encapsulation, fluorescence from MPS-PPV shows two distinct peaks, which suggests the polymer may be in two conformations. A combination of TEM, fluorescence anisotropy, and sucrose gradient separation indicate that the blue peak arises from polymer encapsulated into spherical particles, while the redder peak corresponds to polymers contained in rod-like cages. Ionic strength during assembly can be used to tune the propensity to form rods or spheres. The results illustrate the synergy of hybrid synthetic/biological system – polymer conformation drives the structure of this composite material, which in turn modifies the polymer optical properties. This synergy could be useful for the future development of synthetic/biological hybrid materials with designated functionality.

CACGTCCCAACGCTACATC, ACGTGCCCACCCAGATCAAAA; 36b4 AGTACACCTTCCCACTTACTG, ACCAAGTCAAGAGACT-GTCTC; Tbp ACCCTTCACCAATGACTCCTATG, ATGATGACTG-CAGCAAATCGC. Statistics. The observed birth rate of Lpin2/3-KO mice was compared with the expected number (according to Mendelian inheritance) by χ 2 test. Quantitative results are presented as mean ± SD. Two-way ANOVA or 1-way ANOVA, followed by Bonferroni's correction was used for multiple comparisons (Stata 11). A value of P < 0.05 was considered statistically significant. Study approval. The Institutional Animal Care and Use Committee of UCLA approved all animal experimental protocols.

Strategies to increase energy expenditure are an attractive approach to reduce excess fat storage and body weight to improve metabolic health. In mammals, uncoupling protein-1 (UCP1) in brown and beige adipocytes uncouples fatty acid oxidation from ATP generation in mitochondria and promotes energy dissipation as heat. We set out to identify small molecules that enhance UCP1 levels and activity using a high-throughput screen of nearly 12,000 compounds in mouse brown adipocytes. We identified a family of compounds that increase Ucp1 expression and mitochondrial activity (including uncoupled respiration) in mouse brown adipocytes and human brown and white adipocytes. The mechanism of action may be through compound binding to A kinase anchoring protein (AKAP) 1, modulating its localization to mitochondria and its interaction with protein kinase A (PKA), a known node in the β-adrenergic signaling pathway. In mice, the hit compound increased body temperature, UCP1 protein levels, and thermogenic gene expression. Some of the compound effects on mitochondrial function were UCP1- or AKAP1-independent, suggesting compound effects on multiple nodes of energy regulation. Overall, our results highlight a role for AKAP1 in thermogenesis, uncoupled respiration, and regulation energy balance.