BackgroundThe present study aimed to direct detect Mycobacterium bovis in milk (n = 401) and blood (n = 401) samples collected from 401 dairy cows of 20 properties located in the state of Pernambuco, Brazil, by real-time quantitative PCR (qPCR) targeting the region of difference 4 (RD4). Risk factors possibly associated with bovine tuberculosis (BTB) were also evaluated.ResultsOf the 802 samples analyzed, one milk (0.25 %) and eight blood (2 %) samples were positive for M. bovis in the qPCR and their identities were confirmed by sequencing. Animals positive for M. bovis were found in six (30 %) of the 20 properties visited. None of the risk factors evaluated were statistically associated with BTB.ConclusionsM. bovis DNA was detected in one milk sample what may pose a risk to public health because raw milk is commonly consumed in Brazil.

ResumoA cinomose é causada por Morbilivirus e tem distribuição mundial, sendo o cão o principal reservatório para o vírus. A transmissão ocorre através de aerossóis sendo que este pode ser excretado no fim da fase aguda. Trata-se de uma doença sem predileção por raça, idade ou sexo, no entanto a literatura cita que filhotes são mais acometidos. No estudo realizado foram analisadas amostras de soro de cães domiciliados, nos bairros do município de Garanhuns sendo os bairros escolhidos a Boa Vista, Cohab 1, Cohab 2, Magano e Centro, durante o período de agosto a dezembro de 2012. Foram coletadas amostras de cães com idade superior a três meses, não vacinados contra a cinomose. Para elaboração dos mapas de distribuição geográfica dos animais foram coletadas coordenadas em cada casa visitada para a coleta. Das amostras analisadas, 90,38% foram positivas, sendo que 28,72% apresentaram concentração alta de anticorpos, 47,88% concentração média e 23,40% concentração baixa. Ao analisar a distribuição por bairros observou-se uma maior prevalência da infecção nos bairros Cohab 2 com 100,00% e Cohab 1 com 96,00%; seguido do bairro Boa Vista com 93,10%; Magano com 78,26%; Centro com 50,00%. Neste estudo não foi identificada nenhuma variável associada à infecção referente ao sexo, pois foram acometidos tanto machos quanto fêmeas e 100,0% dos animais, incluindo positivos e negativos, não eram castrados. Foi evidenciado que 75,0% dos animais nunca tinham sido levados ao veterinário, e destes, 94,8% foram positivos, fato este que pode estar relacionado à maior soropositividade nestes animais. Os resultados obtidos nesse estudo mostram que o vírus da cinomose canina encontra-se disseminado na população canina de Garanhuns, Pernambuco, destaca-se a importância de estudos epidemiológicos para a caracterização da real situação da infecção por este vírus nas populações caninas, com o intuito de reduzir os prejuízos à saúde animal provocados pelo agente.

We used the polymerase chain reaction to identify virulence genes in cervico-vaginal mucus samples from cows positive for Campylobacter fetus subsp. venerealis. There was positivity for the pldA, racR, dnaJ, cdtA, and cdtB genes. No samples showed the cdtC, ciaB, cadF, wlaN, and virB11 genes.

Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction  was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems.

The identification of Listeria spp. in food handling areas is of great concern to health surveillance agencies, and their control is often hampered by the ability of the bacteria to grow and maintain themselves even under adverse conditions. The present study aimed to isolate and identify Listeria spp. in the food handling areas of 10 retail food stores in the state of Pernambuco, Brazil. Eighty-six swab samples were collected from equipment, utensils and surfaces used for processing ready-to-eat meat products. The Dry and Wet Swabbing Methods (3M™ Quick Swabs) and 3M™ Petrifilm™ Plates were used to identify Listeria spp. Contamination by Listeria monocytogenes was confirmed by the Real-time Polymerase Chain Reaction (qPCR). The hygienic and sanitary conditions of the food handling areas of each store were also assessed. Listeria spp. was isolated in eight stores (80%). Of the 86 swab samples analyzed, 27 (31.2%) [confidence interval 21.81% to 42.30%] were positive for Listeria spp. and only one (3.7%) was confirmed as Listeria monocytogenes. The main contamination sites were the floor (50.0%), the plastic cutting board (42.9%) and the knife (40.0%). None of the hygienic and sanitary conditions assessed in the present study were associated with contamination by Listeria spp. (p = 0.700). It was concluded that Listeria spp. was widely distributed in the retail food stores studied, being a possible risk factor for public health.

RESUMO: Objetivou-se com este estudo determinar a ocorrência e os fatores de risco associados à infecção por Campylobacter spp. em criações de ovinos no estado de Pernambuco, Brasil. Foram coletadas 421 amostras fecais de ovinos procedentes de 20 rebanhos para o isolamento de Campylobacter spp. As espécies Campylobacter fetus subsp. fetus e Campylobacter jejuni foram identificadas por Reação em Cadeia da Polimerase (PCR). Para análise dos fatores de risco foi realizada uma análise univariada e posteriormente regressão logística a partir de questionário com perguntas objetivas sobre o manejo higiênico-sanitário e reprodutivo. A ocorrência para Campylobacter spp. foi de 4,5% (19/421; I.C. 2,8% - 7,1%). Das 19 amostras positivas no cultivo, oito (1,9%; I.C. 0,9% - 3,9%) foram classificadas como C. fetus subsp. fetus e sete (1,7%; I.C. 0,7% - 3,6%) como C. jejuni, com co-infecção em quatro amostras (0,95%). O número de focos identificados foi de 35,0% (7/20) das criações de ovinos que apresentavam pelo menos um animal positivo. Na análise de regressão logística não foi identificada nenhuma das variáveis como fator de risco. Este é o primeiro registro da infecção por Campylobacter spp. em rebanhos ovinos no Nordeste do Brasil, concluindo-se que a infecção ocorre nesses rebanhos. Dessa forma, se faz necessário à implementação de medidas de controle e prevenção, para impedir a propagação do agente entre as criações, evitando prejuízos para ovinocultura e riscos para saúde pública, uma vez que a campilobacteriose é considerada uma zoonose emergente.

The objective of this study was to conduct a seroepidemiological survey of Chlamydia abortus infection in dairy cattle herds. A total of 303 blood serum samples were collected from 24 property in Vale do Ipanema microregion in the state of Pernambuco, Brazil. For the diagnosis of C. abortus infection, a commercial enzyme immunoassay kit (ELISA) was used. A prevalence of 34.0% (103/303; 95% CI: 28.7%-39.7%) of infected animals was identified. In 79.8% (19/24) of the properties, at least one infected animal was detected. The risk factors identified were: semi-intensive system (OR = 3.47, p ≤ 0.000), extensive system (OR = 8.14; p ≤ 0.000), supply of water in troughs and directly at the fountain (OR = 2.29, p = 0.002), pasture rent (OR = 1.72, p = 0.041), use of artificial insemination (AI) (OR = 3.07, p = 0.002), and use of AI associated with natural mount (OR = 2.22, p = 0.003). The occurrence of C. abortus infection in dairy cattle in the state of Pernambuco, Brazil, was recorded for the first time. It is concluded that the infection by this agent is present in the analyzed herds and that hygienic and sanitary management measures based on the identified risk factors should be implemented to avoid reproductive losses and losses to the producers.

Resumo Objetivou-se com este trabalho identificar a ocorrência de genes codificadores de enterotoxinas estafilocócicas (sea, seb, sec e seg) e do gene da toxina 1 responsável pela síndrome do choque tóxico (tst) em isolados de Staphylococcus aureus procedentes de casos de mastite bovina, no estado de Pernambuco, Brasil. Foram analisados 93 isolados e observou-se a presença de genes toxigênicos em 20 (21,6%) deles, dos quais 11 (55,0%) foram positivos para o gene tst, sete (35,0%) para o gene sec e dois (10,0%) para o gene seg. Dentre os 20 isolados que amplificaram na PCR para presença dos genes sec, seg e tst, 16 (80,0%) foram positivos apenas para um gene e quatro (20,0%) foram positivos para dois genes (sec e tst). Das 17 propriedades de onde as amostras tiveram origem, sete (41,2%) apresentaram amostras positivas para pelo menos um dos genes sec, seg e tst. Este é primeiro registro de ocorrência dos genes codificadores das enterotoxinas SEC e TST-1 em amostras de leite de vacas com mastite no estado de Pernambuco, Brasil.